Freethought & Rationalism ArchiveThe archives are read only. |
10-12-2002, 06:57 PM | #1 | |||||
Regular Member
Join Date: Jul 2002
Location: Australia
Posts: 214
|
The urate oxidase pseudogene: the common ancestry of errors
The following evidence I feel amply demonstrates the common ancestry (and not "common design") of chimpanzees and human beings and why DNA homology is excellent evidence for evolution
the following is a multiple alignment of the sequences of human, chimp, orangutan and owl monkey urate oxidase sequences. The premature stop codon is in bold and italics. Human Urate Oxidase Psuedogene CDS (exons 1-8) <a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=20 513570&do" target="_blank">http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=20 513570&do</a> pt=GenBank (see the end of the post for corroboration) Orangutan Urate Oxidase pseudogene CDS (exons 1-8) <a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=20 513597&dopt=GenBank" target="_blank">http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=20 513597&dopt=GenBank</a> Chimpanzee Urate Oxidase Pseudogene CDS (exons 1 -8) <a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=20 513579&dopt=GenBank" target="_blank">http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=20 513579&dopt=GenBank</a> Spider Monkey Urate Oxidase (exons 1-8) <a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=20 513645&dopt=GenBank" target="_blank">http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=20 513645&dopt=GenBank</a> [code]CLUSTAL X (1.81) multiple sequence alignment human ATGGCCCACTACCATAACAACTATAAAAAGAATGATGAGGTGGAGTTTGT CCGAACTGGC chimpanzee ATGGCCCACTACCATAACAACTATAAAAAGAATGATGAGGTGGAGTTTGT CCGAACTGGC orangutan ATGGCCCACTACCGTAACAACTATAAAAAGAATGATGAGGTGGAGTTTGT CCGAACTGGC owlmonkey ATGGCCCACTACCATAACGACTATAAAAAGAACGATGAGGTGGAGTTTGT ACGAACTGGC ************* **** ************* ***************** ********* human TATGGGAAGGAAATGGTAAAAGTTCTCCATATTCAGTGAGATGGAAAATATCACAGCATT chimpanzee TATGGGAAGGATATGGTAAAAGTTCTCCATATTCAGTGAGATGGAAAATATCACAGCATT orangutan TATGGGAAGGATATGGTAAAAGTTCTCCATATTCAGTGAGATGGAAAATATCACAGCATT owlmonkey TATGGGAAGGATATGGTAAAAGTCCTCCATATTCAGCGAGATGGAAAATATCACAGCATT *********** *********** ************ *********************** human AAAGAGGTGGCAACTTCAGTGCAACTTACTCTAAGTTCCAAAAAAGATTA CCTGCATGGA chimpanzee AAAGAGGTGGCAACTTCAGTGCAACTTACTCTAAGTTCCAAAAAAGATTA CCTGCATGGA orangutan AAAGAGGTGGCAACTTCAGTGCAACTTACTCTGAGTTCCAAAAAAGATTA CCTGCATGGA owlmonkey AAAGAGGTGGCAACTTCAGTGCAACTTACTCTGAGTTCCAAAAAAGATTA CCTGCATGGA ******************************** *************************** human GATAATTCAGACATCATCCCTACAGACACCATCAAGAACACAGTTCATGT CTTGGCAAAG chimpanzee GATAATTCAGACATCATCCCTACAGACACCATCAAGAACACAGTTCATGT CTTGGCAAAG orangutan GATAATTCAGACATCATCCCTACAGACACCATCAAGAACACAGTTCATGT CTTGGCAAAG owlmonkey GACAATTCAGATATCATCCCTACAGACACCATCAAGAACACAGTTCATGC CTTGGCAAAG ** ******** ************************************* ********** human TTTAAAGAAATCAAAAGCATAGAAGCCTTTGGTGTGAATATTTGTGAGCA TTTTCTTTCT chimpanzee TTTAAAGAAATCAAAAGCATAGAAGCCTTTGGTGTGAATATTTGTGAGCA TTTTCTTTCT orangutan TTTAAAGGAATCAAAAGCATAGAAGCCTTTGGTGTGAATATTTGTGAGCA TTTTCTTTCT owlmonkey TTTAAAGGAATCAAAAGCATAGAAGCCTTTGCTGTGAATATTTGTCAGCA TTTTCTTTCT ******* *********************** ************* ************** human TCTTTTAACCATGTAATCCGAGCTCAAGTCTACATGGAAGAAATCCCTTG GAAGCATCTT chimpanzee TCTTTTAACCATGTAATCCGAGCTCAAGTCTATGTGGAAGAAATCCCTTG GAAGCATCTT orangutan TCTTTTAACCATGTAATCTGAGCTCAAGTCTACGTGGAAGAAATTCCTTG GAAGCATCTT owlmonkey TCTTTTAACCATGTCATCCGAACTCAAGTCTATGTGGAAGAAATCCCTTG GAAGCGGCTT ************** *** ** ********** ********** ********** *** human GGAAAGAATGGAGTTAAGCATGTCCATGCATTTATTCACACTCCCACTGG AACACACTTC chimpanzee GAAAAGAATGGAGTTAAGCATGTCCATGCATTTATTCACACTCCCACTGG AACACACTTC orangutan GAAAAGAATGGAGTTAAGCATGTCCATGCATTTATTCACACTCCCACTGG AACACACTTC owlmonkey GAAAAGAATGGAGTTAAGCATGTCCATGCATTTATTCACACTCCCACTGG AACACACTTC * ************************************************** ******** human TGTGAAGTTGAACAGCTGAGAAGTGGACCCCAAGTCATTCATTCTGGAAT CAAAGACCTC chimpanzee GGTGAAGTTGAACAGCTGAGAAGTGGACCCCAAGTCATTCATTCTGGAAT CAAAGACCTC orangutan TGTGAAGTTGAACAGCTGAGAAGTGGACCCCCAGTCATTCATTCTGGAAT CAAAGACCTC owlmonkey TGTGA-GTTGAACAGCTGAGAAGTGGACCCCCAGTTATTCATTCTGGAATCAAAGA CCTC **** ************************* *** ************************ human AAGGTCTTGAAAACAACACAGTCTGGATTTGAAGGTTTCATCAAGGACCA GTTCACTACC chimpanzee AAGCTCTTGAAAACAACACAGTCTGGATTTGAAGGTTTCATCAAGGACCA GTTCACTACC orangutan AAGGTCTTGAAAACAACATAGTCTCGATGTGACGGTTTCATCAAGGACCA GTTCACTACC owlmonkey AAGGTCTTGAAAACAACCCAGTCTGGATTTGAAGGTTTCATCAAGGACCA GTTCACCACC *** ************* ***** *** *** *********************** *** human CTCCCTGAGGTGAAGGACTGATGCTTTGCCACCCAAGTGTACTGCAAGTG GCGCTACCAC chimpanzee CTCCCTGAGGTGAAGGACTGATGCTTTGCCACCCAAGTGTACTGCAAGTG ACGCTACCAC orangutan CTCCCTGAGGTGAAGGACCGATGCTTTGCCACCCAAGTGTACTGCAAGTG GCGCTACCAC owlmonkey CTCCCTGAGGTGAAGGACCGATGCTTTGCCGCACAAGTATACTGCAAGTG GCGCTACCAC ****************** *********** * ***** *********** ********* human CAGTGCAGGGATGTGGACTTCAAGGCTACCTGGGACACCATTCGGGACCT TGTCATGGAG chimpanzee CAGTGCAGGGATGTGGACTTCAAGGCTACCTGGGACACCATTCGGGACCT TGTCATGGAG orangutan CAGTGCAGGGATGTGGACTTCGAGGCTACCTGGGACACCATTTGGGACCT TGTCCTGGAG owlmonkey CAGTGCAGGGATGTGGACTTCGAGGCTACCTGGGACACCATTCGGGACGT TGTCCTAGAG ********************* ******************** ***** ***** * *** human AAATCTGCTGGGCCCTATGACAAAGGTGAATACTTGACCTCTGTGCAGAA GACCCTCTGT chimpanzee AAATCTGCTGGGCCCTATGACAAAGATGAATACTCGCCCTCTGTGCAGAA GACCCTCTGT orangutan AAATCTGCTGGGCCNTATGACAAAGGCGAATACTTGCCCTCTGTGCAGAA GACCCTCTAT owlmonkey AAATTTGCTGGGCCCTATGACAAAGGCGAGTACTCGCCGTCTGTGCAGAA GACCCTCTAT **** ********* ********** ** **** * * ******************* * human GATATCCAGGTGCTCTCCCTGAGCCGAGTTCCTGCGATAGAAGATATGGA AATCAGCCTG chimpanzee GATATCCAGGTGCTCTCCCTGAGCCGAGTTCCTGCGATAGAAGATATGGA AATCAGCCTG orangutan GATATCCAGGTGCTCTCCCTGTGCCGAGTTCCTGAGATAGAAGATATGGA AATCAGCCTG owlmonkey GATATCCAGGTGGTCTCCCTGAGTCAAGTCCCTGAGATAGACGATATGGA AATCAGCCTG ************ ******** * * *** **** ****** ****************** human CCAAACATTCACTACTTCAACATAGACATGTCCAAAATGGGTCTGATCAA CAAGGAAGAG chimpanzee CCAAACATTCACTACTTCAACATAGACATGTCCAAAATGGGTCTGATCAA CAAGGAAGAG orangutan CCAAACATTCACTACTTCAACATAGACATGTCCAAAATGGGTCTGATCAA CAAGGAAGAG owlmonkey CCAAACATTCACTACTTCAACATAGACATGTCCAAAATGGGTCTGATCAA CAAGGAAGAG ************************************************** ********** human GTCTTGCTGCCATTAGACAATCCATATGGAAAAATTACTGGTACAGTCAA GAGGAAGTTG chimpanzee GTCTTGCTGCCATTAGACAATCCATATGGAAAAATTACTGGTACAGTCAA GAGGAAGTTG orangutan GTCTTGCTGCCATTAGACAATCCATATGGAGAAATTACTGGTACAGTCAA GAGGAAGTTG owlmonkey GTCTTGCTGCCATTAGACAATCCATATGGCAAAATTACTGGTACAGTCAA GAGGAAGTTG ***************************** ***************************** human TCTTCAAGACTGTGA chimpanzee TCTTCAAGACTGTGA orangutan TCTTCAAGACTGTGA owlmonkey TCTTCGAGACTGTGA ***** *********</pre>[/quote] *'s represent nucleotides that are identical. Spaces indicate differences. Human Urate Oxidase Pseudogene translated: Met A H Y H N N Y K K N D E V E F V R T G Y G K E Met V K V L H I Q Stop D G K Y H S I K E V A T S V Q L T L S S K K D Y L H G D N S D I I P T D T I K N T V H V L A K F K E I K S I E A F G V N I C E H F L S S F N H V I R A Q V Y Met E E I P W K H L G K N G V K H V H A F I H T P T G T H F C E V E Q L R S G P Q V I H S G I K D L K V L K T T Q S G F E G F I K D Q F T T L P E V K D Stop C F A T Q V Y C K W R Y H Q C R D V D F K A T W D T I R D L V Met E K S A G P Y D K G E Y L T S V Q K T L C D I Q V L S L S R V P A I E D Met E I S L P N I H Y F N I D Met S K Met G L I N K E E V L L P L D N P Y G K I T G T V K R K L S S R L Stop Notice the translated sequence of the pseudogene has several "premature stop codons" A premature stop codon is one that appears in the middle of a gene, rather than at the end. What this effectively does is truncate the protein - it is no longer translated to the end. i.e. instead of getting the entire sequence translated, what you get instead is Met A H Y H N N Y K K N D E V E F V R T G Y G K E Met V K V L H I Q Stop This renders the gene non-functional. It is severely truncated, it is missing its C- terminal signal peptide which targets it to peroxisome, where it would usually function. Its also missing about 90 percent of the original protein. The premature stop codon occurs in the same place in humans, gorillas, chimpanzees and orangutans A fully functional copy of urate oxidase <a href="http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=20 513645&dopt=GenBank" target="_blank">http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=20 513645&do pt=GenBank</a> Aotus trivirgatus (owl monkey) urate oxidase gene: atggcccact accataacga ctataaaaag aacgatgagg tggagtttgt acgaactggc tatgggaagg atatggtaaa agtcctccat attcagcgag atggaaaata tcacagcatt aaagaggtgg caacttcagt gcaacttact ctgagttcca aaaaagatta cctgcatgga gacaattcag atatcatccc tacagacacc atcaagaaca cagttcatgc cttggcaaag tttaaagga atcaaaagca tagaagcctt tgctgtgaat atttgtcagc attttctttc ttcttttaac catgtcatcc gaactcaagt ctatgtggaa gaaatccctt ggaagcggct tgaaaag aatggagtta agcatgtcca tgcatttatt cacactccca ctggaacaca cttctgtga gttgaacagc tgagaagt ggacccccag ttattcattc tggaatcaaa gacctcaagg tcttgaaaac aacccagtct ggatttgaag gtttcatcaa ggaccagttc accaccctcc ctgaggtgaa ggaccgatgc tttgccgcac aagtatactg caagtggcgc taccaccagt gcagggatgt ggacttcgag gctacctgg gacaccattc gggacgttgt cctagagaaa tttgctgggc cctatgacaa aggcgagtac tcgccgtctg tgcagaagac cctctatgat atccaggtgg tctccctgag tcaagtccct gagatagacgata tggaaatcag cctgccaaac attcactact tcaacataga catgtccaaa atgggtctga tcaacaagga agaggtcttgctgc cattagacaa tccatatggc aaaattactg gtacagtcaa gaggaagttg tcttcgagac tgtga Translation: Met A H Y H N D Y K K N D E V E F V R T G Y G K D Met V K V L H I Q R D G K Y H S I K E V A T S V Q L T L S S K K D Y L H G D N S D I I P T D T I K N T V H A L A K F K G I K S I E A F A V N I C Q H F L S S F N H V I R T Q V Y V E E I P W K R L E K N G V K H V H A F I H T P T G T H F C E V E Q L R S G P P V I H S G I K D L K V L K T T Q S G F E G F I K D Q F T T L P E V K D R C F A A Q V Y C K W R Y H Q C R D V D F E A T W D T I R D V V L E K F A G P Y D K G E Y S P S V Q K T L Y D I Q V V S L S Q V P E I D D Met E I S L P N I H Y F N I D Met S K Met G L I N K E E V L L P L D N P Y G K I T G T V K R K L S S R L Stop Blast pairwise alignments: human/owl monkey: Score = 1483 bits (771), Expect = 0.0 Identities = 867/915 (94%) Strand = Plus / Plus As you can no doubt see, this functional copy has only one stop codon, at the end of the protein. It is also 94 percent homologous to the pseudogenes in humans. some additional information: Function of urate oxidase: <a href="http://www.biochem.missouri.edu/ptipton_urate.html" target="_blank">http://www.biochem.missouri.edu/ptipton_urate.html</a> Nonsense mediated Decay: <a href="http://www.ncbi.nlm.nih.gov/Coffeebreak/CB7_NMD/page.html" target="_blank">http://www.ncbi.nlm.nih.gov/Coffeebreak/CB7_NMD/page.html</a> Quote:
Quote:
If you want anything explained, just ask Quote:
Quote:
Quote:
|
|||||
10-12-2002, 07:17 PM | #2 |
Veteran
Join Date: Aug 2001
Location: Snyder,Texas,USA
Posts: 4,411
|
Hey, thanks, Monkenstick, for this expanded version of this stuff! I posted the human and chimp sequences on three different creationist-dominated fora maybe a month ago (after Van gave you no answers here) and have gotten NO answers yet. They don't seem to like hard questions.
(Well, I got one answer when I asked "Was it common ancestry or Bonzo getting cursed along with Adam and Eve?" He chose the latter.) |
10-12-2002, 08:43 PM | #3 |
Veteran Member
Join Date: Jul 2001
Location: Orion Arm of the Milky Way Galaxy
Posts: 3,092
|
monkenstick,
I have an idea of how to present this argument better though it will require it be done as a web page. You give three rather lengthy nucleotide sequences. (Okay lengthy to a human reader not lengthy in genomic terms.) Unless a person slowly compares the "letters" one-by-one this (and how many readers will do this?), the identities will not be obvious. What needs to be done is to use a monospaced font and to put the three on top of each other. [code] atggcccact accataacaa ctataaaaaga atgatgagg tggagtttgt ccgaactggc tatgggaagg aaatggtaaa agttctccat attcagtgag atggcccact accataacaa ctataaaaag aatgatgagg tggagtttgt ccgaactggc tatgggaagg atatggtaaa agttctccat attcagtgag atggcccact accataacga ctataaaaag aacgatgagg tggagtttgt acgaactggc tatgggaagg atatggtaaa agtcctccat attcagcgag </pre>[/quote] Different colors could code for similarity or differences. Then you can explain what blast is. Many of us here know what it is, but 99% of average Joes don't know and can't be faulted for not knowing. |
10-12-2002, 08:50 PM | #4 |
Regular Member
Join Date: Jul 2002
Location: Australia
Posts: 214
|
yeah, I tried posting a clustalw alignment and a blast alignment but the formatting gets ruined so you can't really see the alignment - I might right it up properly as a html document and post it somewhere.
|
10-12-2002, 10:40 PM | #5 |
Regular Member
Join Date: Jul 2002
Location: Australia
Posts: 214
|
that was such a pain in the arse...
I don't know the code to make it all line up properly so I had to use dots, and x's anyway, i think its clear enough now |
10-12-2002, 10:47 PM | #6 |
Senior Member
Join Date: Dec 2001
Location: Toronto, Ontario, Canada
Posts: 762
|
One thing: those "[ October 12, 2002: Message edited by: monkenstick ]" lines aren't hard-coded; if you edit it one more time, you can get rid of them all and when you save it one last time, only one will be present at the bottom.
Other than that, excellent post (and it got even better from the last time around.) Edit: The [ CODE ] [ / CODE ] (without the spaces) UBB command is the one that will display in a monospaced font, which will make it line up as was indicated. [code]Like this</pre>[/quote] [ October 12, 2002: Message edited by: Kevin Dorner ]</p> |
10-12-2002, 10:52 PM | #7 |
Veteran Member
Join Date: Nov 2001
Location: NCSU
Posts: 5,853
|
MS,
Use code brackets; they should allow you to use extra spaces to align sequences. Example. [code] human ATGGCCCACTACCATAACAACTATAAAAAGAATGATGAGGTGGAGTTTGT CCGAACTGGC chimpanzee ATGGCCCACTACCATAACAACTATAAAAAGAATGATGAGGTGGAGTTTGT CCGAACTGGC orangutan ATGGCCCACTACCGTAACAACTATAAAAAGAATGATGAGGTGGAGTTTGT CCGAACTGGC ************* ********************************************** </pre>[/quote] See how it works. Just put your info with in [ code ] and [ /code ], minus the spaces. Edited to Add: Looks like Kevin and I had the same idea. [ October 12, 2002: Message edited by: RufusAtticus ]</p> |
10-12-2002, 10:57 PM | #8 |
Veteran Member
Join Date: Nov 2001
Location: NCSU
Posts: 5,853
|
Also, do you have any data on phylogenic trees constructed with this pseudogene?
|
10-12-2002, 11:25 PM | #9 |
Regular Member
Join Date: Jul 2002
Location: Australia
Posts: 214
|
no rufus, I can't get the original article through my university's proxy so I don't know, I could make some with phylip, but i'd have to upload them to a website - I might try making a webpage out of this
|
10-13-2002, 12:42 PM | #10 | |
Veteran
Join Date: Aug 2001
Location: Snyder,Texas,USA
Posts: 4,411
|
Quote:
|
|
Thread Tools | Search this Thread |
|