Freethought & Rationalism Archive

Godless Dave · 05-30-2002, 09:51 AM

I apologize if something like this has been done before. The fact that I came up with it suggests that it's either really obvious or I'm making a mistake. But here goes anyway.

A common argument from Intelligent Design creationists is that mutations cannot add information to DNA. Here's a simple refutation for the layman:

Copy down the following sequence of letters:

GTCAGACCTGACGTGTAGCTGTACGTCAGACTACCTGCATTGCGTACTG
TAACTGGGCCACGTACTGAGGTCAACGCGTAGTCAACGTGTAGCTGTAC
GTCAGACTACCTGCATTGCGTACTGTAACTGGGCCACGTACTGCTGACG
TGTAGCTGTACGTCAGACTACCTGCATTGCGTACTGTAACTGGGCCAGT
CAACGTGTAGCTGTACGTCAGACTACCTGCATTGCGTACTGTAACTGGG
CCACGTACTGCTGACGTGTAGCTGTACGTCAGACTACCTGCATTGCGTT
ACTGAGGTCAACGCGTAGTCAACGTGTAGCTGTACGTCAGACTACCTGC
ATTGCGTACTGTAACTGGGCCACGTACTGCTGACGTGTAGCTGTACGTC
AGACTACCTGCATTGCGTACTGTAAATTGCGTACTGTAACTGGGCCACG
TACTGCTGACGTGTAGCTGTACGTCAGACTACCTCCATTGCGTACTGTA
ACTGGGCCAGTCAACGTGTAGCTGTACGTCAGACTACCTGTCAGACTAC
CTGCATTGCGTACTGTAACTGGGCCAGTCAACGTGTAGCTGTACGTCAG
ACTACCTGCATTCGTACTGTAACTGGGCCACGTACTGCTGACGTGCGTG
TAGCTGTACGTCAGACTACCTGCATTGCGTTACTGAGGTCAACGCGTAG
TCAACGTGTAGCTGTACGTCAGACTACCTGCATTGCGTACTGTAACTGG
GCCACGTACTGCTGACGTGTAGCTGTACGTCAGACTACCTGCATTGCGT
ACTGTAAATTGCGTACTGTAAGC

Now copy it over 100,000 times, on separate pieces of paper. You don't get to check over your work, erase, or make corrections.

The sequence of letters represents a DNA sequence. It's likely that you made at least one mistake when making that many copies. Any mistakes you made in copying the sequence represent mutations. The pages with mistakes on them will have a different sequence of letters than the original. Congratulations, you just added information!

[ May 30, 2002: Message edited by: Godless Dave ]

Coragyps · 05-30-2002, 11:06 AM

Ooh! Ooh! To make it a speck more realistic, copy the page below onto two sheets. Lock the original in a bank vault, and seperately copy each of your two onto two more. Then four make eight...., with never a look back.
Then, when all is finished, build DNA to each distinct recipe, translate them all to proteins, and see if you come up with any new enzymes!

Edited to say: *the page above*. Dammit, it was below when I was typing!

[ May 30, 2002: Message edited by: Coragyps ]

gallo · 05-30-2002, 01:25 PM

I understand, Coragyps. I too have been accused of not knowing which way is up.

theyeti · 05-30-2002, 04:02 PM

There's a thread for cataloging increases in "functional information" at the antievolution.org forum <a href="http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=3cf691001616ffff;act=ST;f=9;t=6" target="_blank">here</a>. This is about studies that show that the genome increased its functional DNA content, and so it doesn't really focus on individual genes (which are hard to show increases of "information" in, since the creos will just say that it's the same information content).

However, the analysis in the OP is correct IMO. Nearly every mutation is an increase in information, since it adds an additional allele to the gene pool. You can never get those creos to think in population terms...

theyeti

KeithHarwood · 05-30-2002, 06:21 PM

Quote:

Originally posted by Godless Dave:

A common argument from Intelligent Design creationists is that mutations cannot add information to DNA.

Putting on my biologist hat (it's a very small hat and didn't fit when I bought it over forty years ago) could we handle this better by saying that mutations add noise and natural selection filters it into information?

lpetrich · 05-30-2002, 06:46 PM

Quote:

Originally posted by KeithHarwood:

Putting on my biologist hat (it's a very small hat and didn't fit when I bought it over forty years ago) could we handle this better by saying that mutations add noise and natural selection filters it into information?

It depends on what one means by "information". Is it raw sequence data or is it specification of function?

Godless Dave · 05-31-2002, 05:47 AM

Quote:

Originally posted by lpetrich:


It depends on what one means by "information". Is it raw sequence data or is it specification of function?

The ID people never define it, so I don't see why I should!

Jack the Bodiless · 05-31-2002, 08:17 AM

I think we could create a useful resource by nailing down each possible definition of "increased information" and providing a detailed, documented case of each.

For instance, the <a href="http://www.nmsr.org/nylon.htm" target="_blank">nylon-eating bacterium</a> is a new trait added to the gene pool, but the number of useful traits in the organism didn't change because it lost the ability to digest normal food. The <a href="http://www.ultranet.com/~jkimball/BiologyPages/A/AmesTest.html" target="_blank">Ames Test</a> is a much-repeated example of a mutation which increases the number of useful traits in the organism, but not in the gene pool (because histidine-synthesizing salmonella bacteria already exist). Neither increases the overall size of the genome, so we also need a similar article about a genome-enlarging mutation.

I think that would give a full set, even without an example which does all three simultaneously. If mutations can make a genome bigger, increase the number of useful traits in an organism, and add traits never before seen in the population: what else is needed? There is no requirement for more than one of these things to happen at any one time.

Any other weird definition of "increased information" in use that isn't covered by these examples?

Edit: I'm trying to think like a cretinist here, and the Ames test might be dismissed as a special case because histidine-synthesis was "the restoration of a broken trait, not the addition of a new one". Any good examples of an increase in the total number of traits that doesn't involve restoration of a previously-existing trait?

[ May 31, 2002: Message edited by: Jack the Bodiless ]

TollHouse · 05-31-2002, 08:48 AM

For those interested, lambslove of Christian Forums is discussing this very topic <a href="http://www.christianforums.com/forums/showthread.php?s=&threadid=14928" target="_blank">here</a>.

Quote:

scientists are perplexed about the actual mechanism of those mutations, since all observed mutations have invloved the loss of genetic material, not the creation of new material
.
.
.
You ought to try to keep up with science, especially if you are going to procliam it to be the ultimate truth.

Hehehe...it's one thing to be wrong, but why do creationists always have to back up their claims with a shitty attitude?

DonaldW112 · 05-31-2002, 09:28 AM

I don't see why this is such a big deal. The amount of information that a genetic code of 3 billion bases can hold is fixed at 4^3,000,000,000 (or something like that). That represents the set of all possible genetic variations. The "information" is all there. What can they mean by new information? It just means that they don't understand what they are talking about. This is not say that 4^3,000,000,000 (or is 3,000,000,000^4 someone already corrected me and I still can't remember) is a small number or the way that gene expression is regulated is simple but all possible genetic sequences could be completed listed -- it is no mystery there is no "new" information.

Donald

05-30-2002, 09:51 AM	#1
Godless Dave Contributor Join Date: Feb 2002 Location: With 10,000 lakes who needs a coast? Posts: 10,762	mutations adding information I apologize if something like this has been done before. The fact that I came up with it suggests that it's either really obvious or I'm making a mistake. But here goes anyway. A common argument from Intelligent Design creationists is that mutations cannot add information to DNA. Here's a simple refutation for the layman: Copy down the following sequence of letters: GTCAGACCTGACGTGTAGCTGTACGTCAGACTACCTGCATTGCGTACTG TAACTGGGCCACGTACTGAGGTCAACGCGTAGTCAACGTGTAGCTGTAC GTCAGACTACCTGCATTGCGTACTGTAACTGGGCCACGTACTGCTGACG TGTAGCTGTACGTCAGACTACCTGCATTGCGTACTGTAACTGGGCCAGT CAACGTGTAGCTGTACGTCAGACTACCTGCATTGCGTACTGTAACTGGG CCACGTACTGCTGACGTGTAGCTGTACGTCAGACTACCTGCATTGCGTT ACTGAGGTCAACGCGTAGTCAACGTGTAGCTGTACGTCAGACTACCTGC ATTGCGTACTGTAACTGGGCCACGTACTGCTGACGTGTAGCTGTACGTC AGACTACCTGCATTGCGTACTGTAAATTGCGTACTGTAACTGGGCCACG TACTGCTGACGTGTAGCTGTACGTCAGACTACCTCCATTGCGTACTGTA ACTGGGCCAGTCAACGTGTAGCTGTACGTCAGACTACCTGTCAGACTAC CTGCATTGCGTACTGTAACTGGGCCAGTCAACGTGTAGCTGTACGTCAG ACTACCTGCATTCGTACTGTAACTGGGCCACGTACTGCTGACGTGCGTG TAGCTGTACGTCAGACTACCTGCATTGCGTTACTGAGGTCAACGCGTAG TCAACGTGTAGCTGTACGTCAGACTACCTGCATTGCGTACTGTAACTGG GCCACGTACTGCTGACGTGTAGCTGTACGTCAGACTACCTGCATTGCGT ACTGTAAATTGCGTACTGTAAGC Now copy it over 100,000 times, on separate pieces of paper. You don't get to check over your work, erase, or make corrections. The sequence of letters represents a DNA sequence. It's likely that you made at least one mistake when making that many copies. Any mistakes you made in copying the sequence represent mutations. The pages with mistakes on them will have a different sequence of letters than the original. Congratulations, you just added information! [ May 30, 2002: Message edited by: Godless Dave ]</p>

05-30-2002, 11:06 AM	#2
Coragyps Veteran Join Date: Aug 2001 Location: Snyder,Texas,USA Posts: 4,411	Ooh! Ooh! To make it a speck more realistic, copy the page below onto two sheets. Lock the original in a bank vault, and seperately copy each of your two onto two more. Then four make eight...., with never a look back. Then, when all is finished, build DNA to each distinct recipe, translate them all to proteins, and see if you come up with any new enzymes! Edited to say: the page above. Dammit, it was below when I was typing! [ May 30, 2002: Message edited by: Coragyps ]</p>

05-31-2002, 08:17 AM	#8
Jack the Bodiless Veteran Member Join Date: Feb 2001 Location: UK Posts: 5,815	I think we could create a useful resource by nailing down each possible definition of "increased information" and providing a detailed, documented case of each. For instance, the <a href="http://www.nmsr.org/nylon.htm" target="_blank">nylon-eating bacterium</a> is a new trait added to the gene pool, but the number of useful traits in the organism didn't change because it lost the ability to digest normal food. The <a href="http://www.ultranet.com/~jkimball/BiologyPages/A/AmesTest.html" target="_blank">Ames Test</a> is a much-repeated example of a mutation which increases the number of useful traits in the organism, but not in the gene pool (because histidine-synthesizing salmonella bacteria already exist). Neither increases the overall size of the genome, so we also need a similar article about a genome-enlarging mutation. I think that would give a full set, even without an example which does all three simultaneously. If mutations can make a genome bigger, increase the number of useful traits in an organism, and add traits never before seen in the population: what else is needed? There is no requirement for more than one of these things to happen at any one time. Any other weird definition of "increased information" in use that isn't covered by these examples? Edit: I'm trying to think like a cretinist here, and the Ames test might be dismissed as a special case because histidine-synthesis was "the restoration of a broken trait, not the addition of a new one". Any good examples of an increase in the total number of traits that doesn't involve restoration of a previously-existing trait? [ May 31, 2002: Message edited by: Jack the Bodiless ]</p>

Thread Tools	Search this Thread
Show Printable Version	Search this Thread: Advanced Search

05-30-2002, 01:25 PM	#3
gallo Regular Member Join Date: Jun 2001 Location: Houston, TX, US Posts: 244	I understand, Coragyps. I too have been accused of not knowing which way is up.

05-30-2002, 04:02 PM	#4
theyeti Veteran Member Join Date: Jun 2001 Location: Denver, CO, USA Posts: 9,747	There's a thread for cataloging increases in "functional information" at the antievolution.org forum <a href="http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=3cf691001616ffff;act=ST;f=9;t=6" target="_blank">here</a>. This is about studies that show that the genome increased its functional DNA content, and so it doesn't really focus on individual genes (which are hard to show increases of "information" in, since the creos will just say that it's the same information content). However, the analysis in the OP is correct IMO. Nearly every mutation is an increase in information, since it adds an additional allele to the gene pool. You can never get those creos to think in population terms... theyeti

05-31-2002, 09:28 AM	#10
DonaldW112 Junior Member Join Date: Sep 2001 Location: Schenectady, NY Posts: 45	I don't see why this is such a big deal. The amount of information that a genetic code of 3 billion bases can hold is fixed at 4^3,000,000,000 (or something like that). That represents the set of all possible genetic variations. The "information" is all there. What can they mean by new information? It just means that they don't understand what they are talking about. This is not say that 4^3,000,000,000 (or is 3,000,000,000^4 someone already corrected me and I still can't remember) is a small number or the way that gene expression is regulated is simple but all possible genetic sequences could be completed listed -- it is no mystery there is no "new" information. Donald

Freethought & Rationalism Archive

The archives are read only.