Freethought & Rationalism Archive

Skeptical · 03-12-2004, 10:17 AM

Sorry if this is a stupid question, but I have searched google till I'm dizzy and I can't find the answer to what I think is a simple question.

To whit:

When G band staining techniques are used to stain chromosomes, what exactly is being "stained"? That is, what parts of the chromosome are stained and what parts aren't and why?

All I have been able to find are instructions for how to use various chemicals to produce varying staining techniques but no detailed explanations of the chemical process itself.

RufusAtticus · 03-12-2004, 10:23 AM

The stain affects the dense parts of the chromosomes, known as heterochromatin. In these sections, the histones (scaffold proteins) are close together which causes the dna they carry to be tightly packed.

Edit to add:

I just looked up G-banding in Genes VII, and it states that the mechanism is a mystery. Perhaps the heterochromatic/euchromatin difference is not the explaination.

Angrillori · 03-12-2004, 10:27 AM

Ok, I think I remeber, but it's been a while.

You might look up poly-G.

I don't know how advanced you are in bio, so I'll start simple:

DNA is identified by 4 nucleotides, abbreviated A, C, G, and T. Any given DNA strand will repeat these four nucleotides over and over again, such as:

AAACGTTCGTGCATTATGCGATAGCGATAGCGATCG.

It does this millions of millions of times.

Now, given millions of tries, you will get groupings of GGGGGG every now and again. If you had another molecule that could bind to groups of several G's (Guanine molecules) when they're lined up, then you could identify different and similar strands of DNA by how many, and where these groups of G's are.

Does that make sense? For example, you could tell that:

ACCACCATCCGCTCATCAGGGGGGGGCTTACATCGCTCAGC is different from:

ACTCTGGGGGGGATCTCATCAGCATCACGCATCGACTCATCAGC which is different from:

ACTCAGGGGGGGGCATCTCAGGGGGGGACTCATCAGAGGGGGG.

Angrillori · 03-12-2004, 10:29 AM

Of course I could be dead wrong.

Haven't studied this stuff in years and years. Sorry. Go with what Rufus said.

RufusAtticus · 03-12-2004, 10:35 AM

It's called "G-banding" because the dye used is "Giemsa."

And while we are on the subject.

Skeptical · 03-12-2004, 10:59 AM

Quote:

Originally posted by RufusAtticus
It's called "G-banding" because the dye used is "Giemsa."

Right, but my question is what is the dye "coloring", exactly. Is it a particular encoding scheme that gets stained and if so, why does that happen?

Quote:

And while we are on the subject.

(snipped picture for brevity)

Thanks for any help

RufusAtticus · 03-12-2004, 11:06 AM

Quote:

Originally posted by Skeptical
Right, but my question is what is the dye "coloring", exactly. Is it a particular encoding scheme that gets stained and if so, why does that happen?

According to Benjamin Lewin in Genes VII, it is a mystery how it works. I'll check Genes VIII and pubmed when I get to the lab.

Skeptical · 03-12-2004, 11:35 AM

Quote:

Originally posted by RufusAtticus
According to Benjamin Lewin in Genes VII, it is a mystery how it works. I'll check Genes VIII and pubmed when I get to the lab.

Interesting. So, do we know how the process was discovered to begin with, was it just a lucky accident?

RufusAtticus · 03-12-2004, 02:25 PM

Here is the relevant section of Genes VIII (p 555).

Quote:

The banding technique is of enormous practical use, but the mechanism of banding remains a mystery. All that is certain is that the dye stains untreated chromosomes more or less uniformly. So the generation of bands depends on a variety of treatments that change the response of the chromosome (presumably by extracting the component that binds the stain from the nonbanded regions.) But similar bands can be generated by a variety of treatments.

The only known feature that distinguishes bands from interbands is that the bands have a lower G-C content than the interbands.

SEF · 03-12-2004, 03:04 PM

One of my text books has rather more historical and experimental detail than that but that also means it is really too much to type in as a quote! I'll try to extract the important bits:

• It discusses Q-, G- and C-bands in metaphase chromosomes.

• Quinacrine staining came first (fluoresces in UV).

• The discovery that giemsa stain could also be used in this way was an accident - a nice side bonus of work on hybridization.

• The variations possible for showing G-bands with saline, alkali or even partial digestion of the chromosome with proteases has led to it being likened to Chinese cookery.

• Whereas Q-banding shows regions of high A-T bonds, G-banding was originally restricted to the regions of chromosomes around their primary constrictions. Once the process was improved to work on the rest of the chromosome, the G-bands were found to largely match the Q-bands (and therefore also be in repetitive A-T areas).

• From comparison with electron micrographs, it is generally regarded to be the case that the G-band technique enhances and intensifies a pattern of condensation bands already present in untreated metaphase chromosomes shown by attached chromatin fibres (ie it causes the fibres to aggregate even more into the densely packed regions of the chromosome).

• G-band techniques have been shown to cause little or no overall loss of DNA or protein.

• These various comparisons of Q-, G- and chromatin bands suggest that the A-T rich sequences (repeated and interspersed throughout chromosomes) are involved in the recognition and cross-linking process which folds in the fibres during condensation.

• It is the precise molecular details of how this linking takes place which remains to be established (as of the date of my book of course!).

03-12-2004, 10:17 AM	#1
Skeptical Regular Member Join Date: Mar 2002 Location: Kentucky Posts: 472	What exactly are G bands? Sorry if this is a stupid question, but I have searched google till I'm dizzy and I can't find the answer to what I think is a simple question. To whit: When G band staining techniques are used to stain chromosomes, what exactly is being "stained"? That is, what parts of the chromosome are stained and what parts aren't and why? All I have been able to find are instructions for how to use various chemicals to produce varying staining techniques but no detailed explanations of the chemical process itself.

03-12-2004, 10:23 AM	#2
RufusAtticus Veteran Member Join Date: Nov 2001 Location: NCSU Posts: 5,853	IIRC, The stain affects the dense parts of the chromosomes, known as heterochromatin. In these sections, the histones (scaffold proteins) are close together which causes the dna they carry to be tightly packed. Edit to add: I just looked up G-banding in Genes VII, and it states that the mechanism is a mystery. Perhaps the heterochromatic/euchromatin difference is not the explaination.

Thread Tools	Search this Thread
Show Printable Version	Search this Thread: Advanced Search

03-12-2004, 10:27 AM	#3
Angrillori Veteran Member Join Date: Mar 2003 Location: A world less bright without WinAce. Posts: 7,482	Ok, I think I remeber, but it's been a while. You might look up poly-G. I don't know how advanced you are in bio, so I'll start simple: DNA is identified by 4 nucleotides, abbreviated A, C, G, and T. Any given DNA strand will repeat these four nucleotides over and over again, such as: AAACGTTCGTGCATTATGCGATAGCGATAGCGATCG. It does this millions of millions of times. Now, given millions of tries, you will get groupings of GGGGGG every now and again. If you had another molecule that could bind to groups of several G's (Guanine molecules) when they're lined up, then you could identify different and similar strands of DNA by how many, and where these groups of G's are. Does that make sense? For example, you could tell that: ACCACCATCCGCTCATCAGGGGGGGGCTTACATCGCTCAGC is different from: ACTCTGGGGGGGATCTCATCAGCATCACGCATCGACTCATCAGC which is different from: ACTCAGGGGGGGGCATCTCAGGGGGGGACTCATCAGAGGGGGG.

03-12-2004, 10:29 AM	#4
Angrillori Veteran Member Join Date: Mar 2003 Location: A world less bright without WinAce. Posts: 7,482	Of course I could be dead wrong. Haven't studied this stuff in years and years. Sorry. Go with what Rufus said.

03-12-2004, 10:35 AM	#5
RufusAtticus Veteran Member Join Date: Nov 2001 Location: NCSU Posts: 5,853	It's called "G-banding" because the dye used is "Giemsa." And while we are on the subject.

03-12-2004, 03:04 PM	#10
SEF Banned Join Date: Feb 2004 Location: UK Posts: 2,179	One of my text books has rather more historical and experimental detail than that but that also means it is really too much to type in as a quote! I'll try to extract the important bits: • It discusses Q-, G- and C-bands in metaphase chromosomes. • Quinacrine staining came first (fluoresces in UV). • The discovery that giemsa stain could also be used in this way was an accident - a nice side bonus of work on hybridization. • The variations possible for showing G-bands with saline, alkali or even partial digestion of the chromosome with proteases has led to it being likened to Chinese cookery. • Whereas Q-banding shows regions of high A-T bonds, G-banding was originally restricted to the regions of chromosomes around their primary constrictions. Once the process was improved to work on the rest of the chromosome, the G-bands were found to largely match the Q-bands (and therefore also be in repetitive A-T areas). • From comparison with electron micrographs, it is generally regarded to be the case that the G-band technique enhances and intensifies a pattern of condensation bands already present in untreated metaphase chromosomes shown by attached chromatin fibres (ie it causes the fibres to aggregate even more into the densely packed regions of the chromosome). • G-band techniques have been shown to cause little or no overall loss of DNA or protein. • These various comparisons of Q-, G- and chromatin bands suggest that the A-T rich sequences (repeated and interspersed throughout chromosomes) are involved in the recognition and cross-linking process which folds in the fibres during condensation. • It is the precise molecular details of how this linking takes place which remains to be established (as of the date of my book of course!).

Freethought & Rationalism Archive

The archives are read only.